Chronicles of Heavenly Demon
160.00 Degree of Dedicated Taxation (神 ⁄ 出 世) (2)
I ran without rest for a while.
There was no proper rest, and I had never been drunk from a dream sleep.
I've been doing that so far.
No, I've always believed I did.
One at this moment, the planet denied it all. I only brainwashed myself into believing that I had lived that way.
I asked myself the question of whether I really lived that hard.
It didn't take long, and I quickly got an answer out of my head.
"I don't know."
"I don't know" is an excuse.
If you've really lived that hard, you should be able to answer. That's how I lived.
I don't know one thing, "means that I did not live like that. I don't know when it started.
It may be right after he left Jamma-dong, or it may be right after he became a minority monk.
No, maybe after getting on the nerves of the mouth and getting on the seat of the thousand.
The moment you think you're getting closer to your goal is the moment when people are most visible. Maybe over time, it has been going on very little by little ever since.
‘Not good. ’
The planet denied it all.
If you have been neglected, you have lived the wrong life. He should have lived harder than anyone else to achieve his goals.
‘It's not too late. ’
The planet grabbed the spear. Then you look for the gangster who swings his sword at you in a row.
Hundreds, not thousands, and tens of thousands of swords rush towards themselves like waves.
Meanwhile, dragons and tigers claw.
The benefits of a dragon power sword that even light transcended. I didn't even know that name.
However, we could see that this sword unfolding before us was aimed at crossing the light in the pursuit of extreme pleasure.
It was the result of looking at it with the eyes of an astronomer.
It was also the result of an atheist's judgment.
‘Then……. ’
To catch up with it, you also need to transcend the light.
When it comes to the Yu and the Hand, the bar is one step ahead of the astronaut, the hexagon, and the Malvase.
If we can contain the ultimate joy, we will be able to chase that sword.
Can you do it? ’
I wondered.
The planet shook its head. The question of questioning itself means that it has not yet gotten rid of the laziness.
It doesn't matter if you can or can't.
If you are fierce on your own, it is important to try it whether it works or not. So it's important to get over this wall.
After that, we had to face each other no matter what.
Boom, boom!
Boom, boom!
The planet throws itself off the fence. My whole body was filled with freedom.
I lost my temper with Iron Man.
‘Do.'
The planet gripped its spear tighter.
Whoa, whoa, whoa.
The white javelin in the hand of the planet trembles as if it were responding to the will of its owner.
At the same time, a white glow began to envelop the white window.
The time captured by the asteroid's senses split into tens of millions. Time began to flow slowly in front of me.
At first it was just a little bit, but the focus of the planet was terribly doubled. The slower the time became.
In that slow time, the planet plunged out all the herds in its head.
A crowd of thousands came to mind. tens of thousands of letters devoured by the brain.
The sequence is a mess.
In it, the ritual of the planets drifts dizzily like a leaf thrown into a furrow.
But the planet didn't lose consciousness in it. Instead, I started collecting them without losing consciousness.
The letters and texts began to run wild. It's like, "We can't mix! ’I felt like I was rebelling against the planet.
The planet gripped its white window tighter. Then he ordered the group to rise up.
‘No, it can be mixed. ’
The asteroid commands once again.
"Blend in!"
The asteroid's command was short but powerful.
It was an unmanned order from the nerves of the mouth, which were all lumped together.
The phrases react to the order.
The empty spheres that had repeated the mountain have finally produced a single verse!
The moment I remembered that verse, lightning struck the brain of the planet and broke what was inside his head.
- I'm fine!
At the same time, the time slowing down began to accelerate again, and the ritual of the asteroid traveled far away and returned to the body.
Boom!
‘What should I say? ’
Among the scattered blades, the planet looked at the white window in its hand.
A new herb floats in my head.
It seems clear to me. I've never opened it, but I'm not familiar with it.
It is probably because it is a herb that has been made together with a group of people who have known so far.
It is also because most of the verses that make up the herb are based on MalyaseongChang and the Sikh waves, rather than on the Thousand Mascot.
What should we call this herbivore?
Completing the verse only means that you now know the meaning. His name is the brother who will bear his righteousness.
It takes a brother and a righteousness to complete it with herbs. Shin Dragon oil is a herb that was made in a way that was unpaid, but it is different now.
The planet slowly shrugs its shining sword at itself.
In the meantime, you can see a bird flapping its wings in the distant sky.
Closer to the sun.
A bird that flies over the sun that is pouring out bright light.
‘Faith.' ’
A bird with God's name on it.
Let's do it.
Birds have big wings that allow them to fly to places where the sun doesn't shine.
Typically the bandages ( ⁄ 40300;) were the same.
A bird that does not fly in ordinary winds, and that once the storm hits, it will cross the Gulman Lee Sea to work.
With such faith, we can fly to places where the light cannot reach.
Soon, the planet named the herbalist.
‘Taxation of new heirs'. ’
The planet moves its spear.
A huge amount of light flows out through the white window, and it snaps and splits like wings. The planet throws its white window straight forward.
Faith has begun to spread its wings to the world.
Creed tax.
A giant bird is shot from a white window and pierces the creature's entire body.
Quaguaguaguaguaguagua -!
The battle seemed to be over.
However, those who witnessed the battle did not easily recognize it.
The waves and bridges have opened their eyes blindly. He will, too, because the overwhelming amount of light that was about to overthrow the world just now did not leave the brain.
Shine from a religious bishop.
It was still attached to the retina. What the hell is that?
What is so fascinating about a man's eyes that he is a shaman?
Many people were curious.
I heard that some of the horsemen in the martial arts tempted people's souls, and I wondered if they were horsemen like that.
The first thing that came to my mind was the amount of coronation.
The monarchs who were pushing the remnants of the Wild Forest from quite a distance also ran toward the planet screaming for Moore.
But sooner than that, there were those who judged and moved quickly.
“Sprinkle the poison! ”
“Release the poison! ”
It was the Four Thousand Party.
At the most appropriate moment, they revealed themselves at the moment they thought the planet would be the most exhausted.
They leap into the battlefield, flying a green flag symbolizing the party's price, relentlessly releasing their poison.
“Glug!”
“Knng!”
The martial artists who were poisoned fell with their mouths closed. It's not just martial artists.
While I was in the middle of the war, the disciples and martial artists were tangled together, and nevertheless, the Four Thousands were poisoned without hesitation.
One of the Moorish fames shouted at him as if protesting.
“What the hell are you doing? Are the Four Thousands this prestigious? ”
At that moment, someone's hand rises over his head.
“Tsk, tsk.”
The moment the voice kicks his tongue as if it were a pity, a monstrous poison seeped through his head and into his whole body.
“Cough! Cough! ”
He was known in his own way as Moorish Mastermind and mediator, but he could not resist.
The poison that flowed in was strong.
The defensive fame fades into a handful of blood, unable to withstand the outback.
Brainwashed and boned, leaving nothing behind. There was only one master like this, even if the Party controlled the poison.
“The Longevity Monk. ”
The planet called out his name. On that call, the sugar dragon walks through the blood, smiling satisfactorily.
Iron Buck - Iron Buck-
It's still full of poisonous blood, but he doesn't seem to mind.
Iron Buck -
He'll turn his whole body into poison. I couldn't have been hurt by a human melted poison.
“I didn't know the Bishop of Religion knew my name. It's an honor."
He said with a shrewd expression. I slowly raised my body to my knees and stared at him.
“You've been waiting all this time. ”
“Yes.”
“Was it to weaken my power first by sending out the acoustics, then sending in an unknown goon? ”
“You know very well. One doesn't just call him a bully. Fluorescent Swordsmanship (20940; up to 24093;). ”
A few minds are startled by the words "Luminous Sword." However, there was no change in the face of the planet.
I didn't care what the name of the dead body was.
“You don't have the courage to stand up for yourself. No matter how much I think about it, you guys look better together. ”
“How's Mado? If Bonga enters Mado, will you accept her? ”
The dragons' eyes twitch when asked by Dangjin Dragon. He looked like he had been insulted.
The expression on Hana's face was unbelievable.
“What are you talking about! ”
“No matter how much you say you're a party planner, there are actions you can do and actions you can't do! What do you mean, you're willing to surrender to Mado after committing a massacre like this? ”
The Unsullied also shouted loudly at Dangjin Dragon.
However, there was no change in his expression at all. The only face waiting for the answer of the planet.
The planet closed its eyes and opened its eyes.
“You don't even know what you're talking about. You have no intention of surrendering to this church, do you? ”
“Is it that obvious? ”
“Awkward acting. ”
Dangjin Dragon grinned. As the fate would have it, he and his party had no intention of surrendering to the bridge.
If I had wanted to surrender in the first place, I wouldn't have done this.
At that time, the horoscope continued.
“Of course, even if you do surrender sincerely, this church will not accept you. ”
Dangjin Dragon's glabella did not miss the moment it was moving, but it was a horoscope.
“This church is not a gutter. ”
The planet waves its hands up and bites the dirt.
“A puddle of shit fits in the gutter. ”
As a sign of it, something busy began to happen on the part of the Faith.
You'll Also Like
-
Demon Cultivator: Heaven and earth are the cauldron, and all living beings are the medicine
Chapter 90 2 hours ago -
Dragon's Origin
Chapter 1570 3 hours ago -
The villain queen eavesdropped on my inner thoughts and won't let me lie down?
Chapter 309 8 hours ago -
Lord Era: I, The Strongest Lord Of The Abyss!
Chapter 1659 10 hours ago -
The journey of film and television world is endless
Chapter 674 12 hours ago -
Plane Supplier: People in high martial arts, trade in the heavens
Chapter 136 13 hours ago -
You called me a demon cultivator and forced me to crawl. Why are you crying when I join the Demon Se
Chapter 397 13 hours ago -
Magic Industrial Age
Chapter 324 13 hours ago -
When the Saint comes, she does not collect food.
Chapter 759 13 hours ago -
Knight Lord: Start with Daily Intelligence
Chapter 266 13 hours ago